Quick Order

Human EED Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EEDcDNA Clone Product Information
cDNA Size:1326
cDNA Description:ORF Clone of Homo sapiens embryonic ectoderm development DNA.
Gene Synonym:HEED, WAIT1, EED
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human EED Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name
  • Ura H, et al. (2011) Eed/Sox2 regulatory loop controls ES cell self-renewal through histone methylation and acetylation. EMBO J. 30(11): 2190-204.
  • Montgomery ND, et al. (2007) Molecular and functional mapping of EED motifs required for PRC2-dependent histone methylation. J Mol Biol. 374(5): 1145-57.
  • Jin Q, et al. (2003) The protein phosphatase-1 (PP1) regulator, nuclear inhibitor of PP1 (NIPP1), interacts with the polycomb group protein, embryonic ectoderm development (EED), and functions as a transcriptional repressor. J Biol Chem. 278(33): 30677-85.
  • Showell C, et al. (2002) Identification of putative interaction partners for the Xenopus Polycomb-group protein Xeed. Gene. 291(1-2): 95-104.
  • Rinchik EM, et al. (1993) N-ethyl-N-nitrosourea-induced prenatally lethal mutations define at least two complementation groups within the embryonic ectoderm development (eed) locus in mouse chromosome 7. Mamm Genome. 4(7): 349-53.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks