After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ORM2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ORM2cDNA Clone Product Information
cDNA Size:607
cDNA Description:ORF Clone of Homo sapiens orosomucoid 2 DNA.
Gene Synonym:AGP2, AGP-B, AGP-B', ORM2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

ORM2 belongs to the calycin superfamily, lipocalin family. Lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. Lipocalins can be found in gram negative bacteria, vertebrate cells, and invertebrate cells, and in plants. They are associated with many biological processes. ORM2 functions as transport protein in the blood stream. It is expressed by the liver and secreted in plasma. It seems that ORM2 function in modulating the activity of the immune system during the acute-phase reaction. It binds various hydrophobic ligands in the interior of its beta-barrel domain. It also binds synthetic drugs and influences their distribution and availability.

  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Zhang X, et al. (2012) The potential role of ORM2 in the development of colorectal cancer. PLoS One. 7(2):e31868.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks