Quick Order

Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTNcDNA Clone Product Information
Gene_bank_ref_id:NM_002825.5
cDNA Size:507
cDNA Description:ORF Clone of Homo sapiens pleiotrophin DNA.
Gene Synonym:HARP, HBNF, HBGF8, NEGF1.
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10288-ACG$325
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10288-ACR$325
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10288-CF$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10288-CH$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10288-CM$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10288-CY$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone)HG10288-M$95
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10288-M-F$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10288-M-H$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10288-M-N$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10288-NF$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10288-NH$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10288-NM$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10288-NY$295
Human Pleiotrophin / PTN Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10288-UT$295
 Learn more about expression Vectors
Neurotrophin & Receptor Related Products
Background

HB-GAM belongs to the pleiotrophin family. During embryonic and early postnatal development, HB-GAM is expressed in the central and peripheral nervous system and also in several non-neural tissues, notably lung, kidney, gut and bone. While in the adult central nervous system, it is expressed in an activity-dependent manner in the hippocampus where it can suppress long term potentiation induction. HB-GAM has a low expression in other areas of the adult brain, but it can be induced by ischemic insults, or targeted neuronal damaged in the entorhinal cortex or in the substantia nigra pars compacta. It is structurally related to midkine and retinoic acid induced heparin-binding protein and has a high affinity for heparin. HB-GAM binds anaplastic lymphoma kinase (ALK) which induces MAPK pathway activation, an important step in the anti-apoptotic signaling of PTN and regulation of cell proliferation. It also functions as a secreted growth factor and induces neurite outgrowth and which is mitogenic for fibroblasts, epithelial, and endothelial cells.

References
  • Vanderwinden JM, et al. (1992) Cellular distribution of the new growth factor pleiotrophin (HB-GAM) mRNA in developing and adult rat tissues. Anat Embryol. 186(4):387-406.
  • Lauri SE, et al. (1996) Activity-induced enhancement of HB-GAM expression in rat hippocampal slices. Neuroreport. 7(10):1670-4.
  • Pavlov I, et al. (2002) Role of heparin-binding growth-associated molecule (HB-GAM) in hippocampal LTP and spatial learning revealed by studies on overexpressing and knockout mice. Mol Cell Neurosci. 20(2):330-42.
  • Size / Price
    Catalog:HG10288-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"