Quick Order

Text Size:AAA

Human IGSF3 transcript variant 2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IGSF3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001007237.1
RefSeq ORF Size:3645bp
cDNA Description:Full length Clone DNA of Homo sapiens immunoglobulin superfamily, member 3, transcript variant 2 with C terminal His tag.
Gene Synonym:V8, EWI-3, MGC117164, IGSF3
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Immunoglobulin superfamily member 3 (IGSF3), also known as Glu-Trp-Ile EWI motif-containing protein 3, IgSF3 and EWI-3 and IGSF3, is a single-pass type I membrane protein which belongs to the EWI subfamily of the Ig Superfamily of molecules. IGSF3 has an overall structural similarity and strong sequence similarity to V7, a human leukocyte surface protein. IGSF3 contains eight Ig-like C2-type (immunoglobulin-like) domains. IGSF3 is expressed in a wide range of tissues with high expression in Placenta, kidney and lung. EWI-2 is part of a novel Ig subfamily that includes EWI-F (F2alpha receptor regulatory protein (FPRP), CD9P-1 ), EWI-3 (IGSF3), and EWI-101 (CD101). All four members of this Ig subfamily contain a Glu-Trp-Ile (EWI) motif not seen in other Ig proteins. Human IGSF3 shares 92 % aa identity with mouse IGSF3.

References
  • Saupe S, et al. (1998) Molecular cloning of a human cDNA IGSF3 encoding an immunoglobulin-like membrane protein: expression and mapping to chromosome band 1p13. Genomics. 52(3): 305-11.
  • Lazaar AL, et al. (2001) VCAM-1 activates phosphatidylinositol 3-kinase and induces p120Cbl phosphorylation in human airway smooth muscle cells. J Immunol. 166(1): 155-61.
  • Wetzel A, et al. (2004) Human Thy-1 (CD90) on activated endothelial cells is a counterreceptor for the leukocyte integrin Mac-1 (CD11b/CD18). J Immunol. 172(6): 3850-9.
  • Size / Price
    Catalog: HG11290-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"