Quick Order

Text Size:AAA

Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TXNDC17cDNA Clone Product Information
cDNA Size:372
cDNA Description:ORF Clone of Homo sapiens thioredoxin domain containing 17 DNA.
Gene Synonym:TRP14, TXNL5, MGC14353, TXNDC17
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11288-ACG$325
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11288-ACR$325
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11288-ANG$325
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11288-ANR$325
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11288-CF$295
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11288-CH$295
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11288-CM$295
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11288-CY$295
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone)HG11288-M$195
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11288-M-F$395
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11288-M-N$395
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11288-NF$295
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11288-NH$295
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11288-NM$295
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11288-NY$295
Human TXNDC17 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11288-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
  • Holmgren A. (1985) Thioredoxin. Annu Rev Biochem. 54: 237-71.
  • Holmgren A. (1995) Thioredoxin structure and mechanism: conformational changes on oxidation of the active-site sulfhydryls to a disulfide. Structure. 3 (3): 239-43.
  • Martin JL. (1995) Thioredoxin--a fold for all reasons. Structure. 3 (3): 245-50.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items