Quick Order

Text Size:AAA

Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PIN1cDNA Clone Product Information
Gene_bank_ref_id:NM_006221.2
cDNA Size:492
cDNA Description:ORF Clone of Homo sapiens peptidylprolyl cis/trans isomerase, NIMA-interacting 1 DNA.
Gene Synonym:PIN1, DOD, UBL5
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10282-ACG$325
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10282-ACR$325
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10282-ANG$325
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10282-ANR$325
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10282-CF$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10282-CH$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10282-CM$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10282-CY$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone)HG10282-M$95
Human Pin1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10282-M-F$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10282-M-N$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10282-NF$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10282-NH$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10282-NM$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10282-NY$295
Human Pin1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10282-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Peptidyl-prolyl cis-trans isomerase Pin1, also known as Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1, Rotamase Pin1 and PIN1, peptidyl-prolyl cis/trans isomerase (PPIase), is a nucleus protein. PIN1 is a peptidyl-prolyl isomerase that can alter the conformation of phosphoproteins and so affect protein function and/or stability. PIN1 regulates a number of proteins important for cell-cycle progression and is presumed to operate as a molecular timer of this important process. PIN1 is an essential PPIase that regulates mitosis presumably by interacting with NIMA and attenuating its mitosis-promoting activity. PIN1 displays a preference for an acidic residue N-terminal to the isomerized proline bond. Alterations in the level of PIN1 can influence hyperproliferative diseases such as cancer. PIN1 has been implicated in multiple aspects of cell cycle regulation. It has been suggested that PIN1 function is required for both normal mitotic progression and reentry into the cell cycle from quiescence. PIN1 is also a target of several oncogenic pathways and is overexpressed in human breast cancer. Its overexpression can lead to upregulation of cyclin-D1 and transformation of breast epithelial cells in collaboration with the oncogenic pathways. PIN1 plays a pivotal role in breast development and may be a promising new anticancer target. Pin1 activity regulates the outcome of proline-directed kinase (e.g. MAPK, CDK or GSK3) signalling and consequently regulates cell proliferation (in part through control of cyclin D1 levels and stability) and cell survival. Recent data also implicate Pin1 as playing an important role in immune responses, at least in part by increasing the stability of cytokine mRNAs by influencing the protein complexes to which they bind.

References
  • Liou YC, et al. (2003) Role of the prolyl isomerase Pin1 in protecting against age-dependent neurodegeneration. Nature. 424(6948): 556-61.
  • Ryo A, et al. (2001) Pin1 regulates turnover and subcellular localization of beta-catenin by inhibiting its interaction with APC. Nat Cell Biol. 3(9): 793-801.
  • Geldner N, et al. (2001) Auxin transport inhibitors block PIN1 cycling and vesicle trafficking. Nature. 413(6854): 425-8.
  • Size / Price
    Catalog:HG10282-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"