After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SMNDC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SMNDC1cDNA Clone Product Information
Gene_bank_ref_id:BC011234
cDNA Size:717
cDNA Description:ORF Clone of Homo sapiens survival motor neuron domain containing 1 DNA.
Gene Synonym:SMNR, SPF30, SMNDC1
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

SMNDC1 gene is a paralog of SMN1 gene, which encodes the survival motor neuron protein, mutations in which are cause of autosomal recessive proximal spinal muscular atrophy. SMNDC1 is a nuclear protein that has been identified as a constituent of the spliceosome complex. SMNDC1 gene is differentially expressed, with abundant levels in skeletal muscle, and may share similar cellular function as the SMN1 gene. SMNDC1 is necessary for spliceosome assembly. Its overexpression causes apoptosis.

References
  • Rappsilber J, et al. (2001) SPF30 is an essential human splicing factor required for assembly of the U4/U5/U6 tri-small nuclear ribonucleoprotein into the spliceosome. J Biol Chem. 276(33): 31142-50.
  • Talbot K, et al. (1999) Characterization of a gene encoding survival motor neuron (SMN)-related protein, a constituent of the spliceosome complex. Hum Mol Genet. 7(13): 2149-56.
  • Neubauer G, et al. (1998) Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat Genet. 20(1):46-50.
  • Size / Price
    Catalog:HG14294-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"