After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GPA33 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPA33 cDNA Clone Product Information
Gene_bank_ref_id:NM_005814.1
RefSeq ORF Size:960bp
cDNA Description:Full length Clone DNA of Homo sapiens glycoprotein A33 (transmembrane) with C terminal His tag.
Gene Synonym:A33, MGC129986, MGC129987, GPA33
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-GPA33-His
Restriction Site:KpnI + XbaI (6kb + 1.01kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Cell surface A33 antigen, also known as glycoprotein A33, is a single-pass type I  membrane protein which is expressed in normal gastrointestinal epithelium and in 95% of colon cancers. GPA33 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. Intracellular traffic and recycling to the cell surface appear to play a major role in GPA33 function and to have an influence on its surface density superseding translational regulation. GPA33 has become a promising target of immunologic therapy strategies, but its biologic function and potential role in tumorigenesis are unknown. EpCAM protein and GPA33 mRNA expressions are specific and sensitive markers of Barrett's metaplasia (BM). GPA33 may also play a role in cell-cell recognition and signaling.

References
  • Heath J.K., et al., 1997, Proc. Natl. Acad. Sci. USA. 94:469-74.
  • Ritter G., et al., 1997, Biochem. Biophys. Res. Commun. 236:682-6.
  • Frey,D. et al., 2008, Cancer Biother Radiopharm  23 (1):65-73.
  • Rageul,J. et al., 2009, Int J Cancer 125 (12):2802-9. 
  • Size / Price
    Catalog: HG11277-CH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"