Quick Order

Human NAA10 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human NAA10 cDNA Clone Product Information
NCBI RefSeq:BC000308
RefSeq ORF Size:708bp
cDNA Description:Full length Clone DNA of Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit with C terminal Myc tag.
Gene Synonym:TE2, ARD1, NATD, ARD1A, DXS707
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ARD1 is a member of the 20-kDa ARF protein family. It is a multifunctional protein. ARD1 has an 18-kDa ADP-ribosylation factor (ARF) domain at the C-terminus (amino acids 403-574), and a 46-kDa N-terminal domain (amino acids 1-402). The C-terminal region of ARD1 may be involved in the formation of both ARD1-ARD1 and ARD1-NAT1 complexes. ARD1 and NAT1 genes are required for the expression of an N-terminal protein acetyltransferase. This activity is required for full repression of the silent mating type locus HML, for sporulation, and for entry into G0. Recombinant ARD1 (amino acids 1-574) or its RING finger domain (amino acids 1-110) produced polyubiquitylated proteins when incubated in vitro with a mammalian E1, an E2 enzyme, ATP, and ubiquitin.

Size / Price
Catalog: HG14293-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"