Quick Order

Text Size:AAA

Human PRC1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRC1 cDNA Clone Product Information
Gene_bank_ref_id:BC003138
RefSeq ORF Size:1863bp
cDNA Description:Full length Clone DNA of Homo sapiens protein regulator of cytokinesis 1 with N terminal Myc tag.
Gene Synonym:ASE1, PRC1
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PRC1 (protein regulator of cytokinesis 1) is a key regulator of cytokinesis that cross-links antiparrallel microtubules at an average distance of 35 nM. It is essential for controlling the spatiotemporal formation of the midzone and successful cytokinesis. PRC1 is required for KIF14 localization to the central spindle and midbody. It is also required to recruit PLK1 to the spindle. PRC1 stimulates PLK1 phosphorylation of RACGAP1 to allow recruitment of ECT2 to the central spindle. It is a homodimer and interacts with the C-terminal Rho-GAP domain and the basic region of RACGAP1. The interaction with RACGAP1 inhibits its GAP activity towards CDC42 in vitro, which may be required for maintaining normal spindle morphology. PRC1 also interacts separately via its N-terminal region with the C-terminus of CENPE, KIF4A and KIF23 during late mitosis. It interacts with KIF14, IF20A and PLK1.

References
  • Jiang W, et al. (1999) PRC1: a human mitotic spindle-associated CDK substrate protein required for cytokinesis. Mol Cell. 2(6):877-85.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):173-8.
  • Mollinari C, et al. (2002) PRC1 is a microtubule binding and bundling protein essential to maintain the mitotic spindle midzone. J Cell Biol. 15 (7):1175-86.
  • Size / Price
    Catalog: HG13280-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"