Quick Order

Cynomolgus monkey CPA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CPA2cDNA Clone Product Information
Gene_bank_ref_id:XM_005550763.1
cDNA Size:1266
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) carboxypeptidase A2 (pancreatic) DNA.
Gene Synonym:CPA2
Species:Cynomolgus
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Human Carboxypeptidase A2 ( CPA2 ) is a secreted pancreatic procarboxy -peptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group. The hydrolytic action of CPA2 was identified with a preference towards long substrates with aromatic amino acids in their C-terminal end, particularly tryptophan. CPA2 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. Three different forms of human pancreatic procarboxypeptidase A have been isolated, and the A1 and A2 forms are always secreted as monomeric proteins with different biochemical properties.

References
  • Catasus, L. et al., 1995. J. Biol. Chem. 270: 6651-6657.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Laethem, RM. et al., 1996, Arch. Biochem. Biophys.332: 8-18.
  • Size / Price
    Catalog:CG90538-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"