After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CCDC47 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCDC47 cDNA Clone Product Information
Gene_bank_ref_id:BC008905
RefSeq ORF Size:1452bp
cDNA Description:Full length Clone DNA of Homo sapiens coiled-coil domain containing 47 with N terminal Myc tag.
Gene Synonym:GK001, MSTP041, CCDC47
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CCDC47 gene is expressed at high level. The gene contains 16 distinct gt-ag introns. Transcription produces 9 different mRNAs, 6 alternatively spliced variants and 3 unspliced forms. There are 3 probable alternative promotors, 3 non overlapping alternative last exons and 8 validated alternative polyadenylation sites. The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of a cassette exon, overlapping exons with different boundaries. Functionally, CCDC47 gene has been proposed to participate in processes such as calcium ion homeostasis, embryo development, ER overload response and post-embryonic development. CCDC47 are expected to have molecular function (calcium ion binding) and to localize in various compartments (membrane, endoplasmic reticulum, integral to membrane, microsome).

References
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Size / Price
    Catalog: HG13274-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"