After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey ANGPTL4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus ANGPTL4 cDNA Clone Product Information
Gene_bank_ref_id:XM_005587832.1
RefSeq ORF Size:720bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) angiopoietin-like 4 with C terminal HA tag.
Gene Synonym:ANGPTL4
Species:Cynomolgus
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

References
  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Catalog: CG90529-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"