After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC6AcDNA Clone Product Information
cDNA Size:630
cDNA Description:ORF Clone of Homo sapiens C-type lectin domain family 6, member A DNA.
Gene Synonym:dectin-2, CLEC6A, CLECSF10
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10250-ACG$325
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10250-ACR$325
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10250-CF$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10250-CH$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10250-CM$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10250-CY$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone)HG10250-M$95
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10250-M-F$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10250-M-N$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10250-NF$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10250-NH$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10250-NM$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10250-NY$295
Human CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10250-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

C-type lectin domain family 4 member N (CLEC4N), also known as Dectin-2, is a C-type lectin expressed by dendritic cells (DCs) and macrophages. Members of the C-type lectin domain (CTLD) superfamily are metazoan proteins functionally important in glycoprotein metabolism, mechanisms of multicellular integration and immunity. They share a common fold and are involved in a variety of functions, such as generalized defense mechanisms against foreign agents, discrimination between healthy and pathogen-infected cells, and endocytosis and blood coagulation. Genome-level studies on human, elegans and melanogaster demonstrated almost complete divergence among invertebrate and mammalian families of CTLD-containing proteins (CTLDcps). The vertebrate CTLDcp family was essentially formed early in vertebrate evolution and is completely different from the invertebrate families. The composition of the CTLDcp superfamily in fish and mammals suggests that large scale duplication events played an important role in the evolution of vertebrates. Dectin-2 is important in host defense against C. albicans by inducing Th17 cell differentiation. Dectin-2 constitutes a major fungal pattern recognition receptor (PRR) that can couple to the Syk-CARD9 innate signaling pathway to activate DCs and regulate adaptive immune responses to fungal infection.

  • Robinson MJ, et al. (2009) Dectin-2 is a Syk-coupled pattern recognition receptor crucial for Th17 responses to fungal infection. J Exp Med. 206(9): 2037-51.
  • Saijo S, et al. (2010) Dectin-2 recognition of alpha-mannans and induction of Th17 cell differentiation is essential for host defense against Candida albicans. Immunity. 32(5): 681-91.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items