After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rhesus AMY2B ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus AMY2B cDNA Clone Product Information
NCBI RefSeq:NM_001266186.1
RefSeq ORF Size:1536bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) amylase, alpha 2B (pancreatic) with C terminal HA tag.
Gene Synonym:AMY2A
Species:Rhesus
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. Alpha-amylase is the major form of amylase found in humans and other mammals. Alpha-amylase hydrolyses alpha bonds of large, alpha-linked polysaccharides, such as starch and glycogen, yielding glucose and maltose. Amylases is widely expressed and is most prominent in pancreatic juice and saliva, each of which has its own isoform of human α-amylase. They behave differently on isoelectric focusing, and can also be separated in testing by using specific monoclonal antibodies.

References
  • Abe A. et al., 2005, FEBS J. 272 (23): 6145-53.
  • Aghajari N. et al., 1998, Protein Sci. 7 (3): 564-72.
  • Ramasubbu N. et al., 1996, Acta Crystallographica Section D Biological Crystallography. 52 (3): 435-46.
  • Size / Price
    Catalog: CG90526-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"