Quick Order

Text Size:AAA

Human CDCP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDCP1cDNA Clone Product Information
cDNA Size:1032
cDNA Description:ORF Clone of Homo sapiens CUB domain containing protein 1 DNA.
Gene Synonym:CD318, TRASK, SIMA135, CDCP1p
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

CDCP1 contains three extracellular CUB domains. It is a putative stem cell marker that is highly expressed in some human cancer cells and in both, typical and atypical (cancerous) colons. It interacts with CDH2/N-cadherin, CDH3/P-cadherin, SDC1/syndecan-1, SDC4/syndecan-4 and the serine protease ST14/MT-SP1. It also interacts with SRC and PRKCG/protein kinase C gamma. CDCP1 is taken as a key regulator of EGF/EGFR-induced cell migration. It has been shown that signaling via EGF/EGFR induces migration of ovarian cancer Caov3 and OVCA420 cells with concomitant up-regulation of CDCP1 mRNA and protein. Consistent with a role in cell migration CDCP1 relocates from cell-cell junctions to punctate structures on filopodia after activation of EGFR. It may be involved in cell adhesion and cell matrix association. It also may play a role in the regulation of anchorage versus migration or proliferation versus differentiation via its phosphorylation. It has been taken as a novel marker for leukemia diagnosis and for immature hematopoietic stem cell subsets.

  • Conze T, et al.. (2003) CDCP1 is a novel marker for hematopoietic stem cells. Ann N Y Acad Sci. 996 (1): 222-6.
  • Hooper JD, et al. (2003) Subtractive immunization using highly metastatic human tumor cells identifies SIMA135/CDCP1, a 135 kDa cell surface phosphorylated glycoprotein antigen. Oncogene. 22(12): 1783-94.
  • Scherl-Mostageer M, et al. (2001) Identification of a novel gene, CDCP1, overexpressed in human colorectal cancer. Oncogene. 20(32):4402-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items