Quick Order

Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CPB1cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:1254
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) carboxypeptidase B1 (tissue) DNA.
Gene Synonym:CPB1
Species:Cynomolgus
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90524-ACG$325
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90524-ACR$325
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90524-ANG$325
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90524-ANR$325
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90524-CF$295
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90524-CH$295
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90524-CM$295
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90524-CY$295
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90524-NF$295
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90524-NH$295
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90524-NM$295
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90524-NY$295
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone)CG90524-U$95
Cynomolgus monkey CPB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90524-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Human Carboxypeptidase B1, also well known as pancreatic procarboxypeptidase B (PCPB), is a highly pancreas -specific protein (PASP), and has been identified previously as a serum marker for acute pancreatitis and pancreatic graft rejection. As the prototype for those human exopeptidases that cleave off basic C-terminal residues, CPB1 specifically cleaves the C-terminal Arg and Lys residues with a preference for Arg. The B1 and B2 forms of procarboxypeptidase B differ from each other mainly in isoelectric point.The deduced amino acid sequence of PCPB predicts a 416-amino acid preproenzyme consisting of a 15-aa signal peptide, a 95-aa activation peptide and a 307-aa mature chain. The secreted PCPB zymogen is converted to enzymatically active CPB1 by limited proteolysis by trypsin.

References
  • Yamamoto, K.K. et al., 1992, J. Biol. Chem. 267: 2575-2581.
  • Pezzilli, R. et al., 1994, Digestion. 55: 73-77.
  • Barbosa Pereira, P.J. et al., 2002, J. Mol. Biol. 321: 537-547.
  • Size / Price
    Catalog:CG90524-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"