Quick Order

Text Size:AAA

Human LY86 / MD-1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LY86 cDNA Clone Product Information
Gene_bank_ref_id:NM_004271.3.
RefSeq ORF Size:489bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphocyte antigen 86 with N terminal His tag.
Gene Synonym:LY86, MD-1, MMD-1, dJ80N2.1, RP1-80N2.1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

MD-1 and MD-2 are secretory glycoproteins that exist on the cell surface in complexes with transmembrane proteins. MD-1 is anchored by radioprotective 105 (RP105) which is a molecule containing leucine-rich repeats and is expressed on B cells, dentritic cells and macrophages, while MD-2 is associated with TLR4. MD-1 is required for efficient RP105 cell surface expression and function. It is indicated that the RP105/MD1 complex, in conjunction with TLR4, mediates the innate immune response to LPS in B cells, and also plays a role in protecting against apoptosis, B-cell proliferation, etc. Mouse MD-1 cDNA encodes a 162 amino acid precursor protein with a putative 19 aa signal peptide and two potential N-linked glycosylation sites. It shares 40% and 66% amino acid sequence identity with chicken and human MD-1 respectively. MD-1 is mainly expressed in spleen, and also detectable in liver, brain, thymus, and kidney.

Size / Price
Catalog: HG10242-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"