Quick Order

Text Size:AAA

Human METAP1 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human METAP1 cDNA Clone Product Information
NCBI RefSeq:NM_015143.2
RefSeq ORF Size:1161bp
cDNA Description:Full length Clone DNA of Homo sapiens methionyl aminopeptidase 1 with N terminal His tag.
Gene Synonym:KIAA0094, DKFZp781C0419
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Processing of the N-terminal initiator methionine or formylated methionine is an essential cellular process conserved from prokaryotes to eukaryotes. The proteolytic removal of N-terminal methionine from nascent peptides is catalyzed by a family of enzymes known as methionine aminopeptidases (MetAPs) and is essential for cell growth. METAP1 and METAP2 have different substrate specificity due to the differences in both size and shape of the active sites. As a member of the M24 family of metalloproteases, METAP1 plays an important role in G(2)/M phase regulation of the cell cycle and may serve as a promising target for the discovery and development of new anticancer agents.

References

1. Lowther, W.T. and B.W. Matthews, 2000, Biochim. Biophys. Acta. 1477: 157 – 167.

2. Addlaqatta, A. et al., 2005, Biochemistry. 44: 14741-14749.

3. Hu, X. et al., 2006, Proc. Natl. Acad. Sci. U.S.A. 103:18148-18153.

Size / Price
Catalog: HG10241-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"