After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LAIR1 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human LAIR1 cDNA Clone Product Information
NCBI RefSeq:BC027899
RefSeq ORF Size:864bp
cDNA Description:Full length Clone DNA of Homo sapiens leukocyte-associated immunoglobulin-like receptor with N terminal Myc tag.
Gene Synonym:CD305, LAIR-1, LAIR1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Leukocyte associated Ig-like receptor-1 (LAIR1) is a surface molecule expressed on human mononuclear leukocytes that functions as an inhibitory receptor on human NK cells. In addition to NK cells, LAIR1 is expressed on T cells, B cells, macrophages, and dendritic cells. It is predicted to mediate inhibitory functions based on the presence of immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in its cytoplasmic domain. Cross-linking of LAIR1 on human T cell clones results in inhibition of cytotoxicity only in T cell clones that lack CD28 and are able to spontaneously lyse certain targets in vitro. Moreover, the cytolytic activity of freshly isolated T cells, which is thought to be mainly due to "effector" T cells, can be inhibited by anti-LAIR1 mAb. Thus, LAIR1 functions as an inhibitory receptor not only on NK cells, but also on human T cells. This indicates that LAIR1 provides a mechanism of regulation of effector T cells and may play a role in the inhibition of unwanted bystander responses mediated by Ag-specific T cells. 

References
  • Meyaard L, et al. (1999) Leukocyte-associated Ig-like receptor-1 functions as an inhibitory receptor on cytotoxic T cells. J Immunol. 162 (10): 5800-4.
  • Meyaard L, et al. (2001) The epithelial cellular adhesion molecule (Ep-CAM) is a ligand for the leukocyte-associated immunoglobulin-like receptor (LAIR). J Exp Med. 194 (1): 107-12.
  • Xu M, et al. (2000) Identification and characterization of leukocyte-associated Ig-like receptor-1 as a major anchor protein of tyrosine phosphatase SHP-1 in hematopoietic cells. J Biol Chem. 275 (23): 17440-6.
  • Size / Price
    Catalog: HG13257-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"