Quick Order

Text Size:AAA

Human LDLR ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LDLR cDNA Clone Product Information
Gene_bank_ref_id:NM_000527.3
RefSeq ORF Size:2583bp
cDNA Description:Full length Clone DNA of Homo sapiens low density lipoprotein receptor with N terminal His tag.
Gene Synonym:FH, FHC
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

LDL Receptor, also known as LDLR, is a mosaic protein which belongs to the Low density lipoprotein receptor gene family. The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. LDL Receptor consists of 840 amino acids (after removal of signal peptide) and mediates the endocytosis of cholesterol-rich LDL. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. LDL Receptor is a cell-surface receptor that recognizes the apoprotein B100 which is embedded in the phospholipid outer layer of LDL particles. The receptor also recognizes the apoE protein found in chylomicron remnants and VLDL remnants.

References
  • Yamamoto T, et al. (1984) The human LDL receptor: a cysteine-rich protein with multiple Alu sequences in its mRNA. Cell. 39(1): 27-38.
  • Mao B, et al. (2001) LDL-receptor-related protein 6 is a receptor for Dickkopf proteins. Nature. 411(6835): 321-5.
  • Pinson KI, et al. (2000) An LDL-receptor-related protein mediates Wnt signalling in mice. Nature. 407(6803): 535-8.
  • Size / Price
    Catalog: HG10231-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"