After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human REG1A Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
REG1AcDNA Clone Product Information
Gene_bank_ref_id:NM_002909.4
cDNA Size:501
cDNA Description:ORF Clone of Homo sapiens regenerating islet-derived 1 alpha DNA.
Gene Synonym:P19, PSP, PTP, REG, ICRF, PSPS, PSPS1, MGC12447, REG1A
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Regenerating (reg) gene encodes protein that has been involved in pancreatic lithogenesis and the regeneration of islet cells and therefore the abnormality of reg genes could be associated with fibrocalculous pancreatopathy. REG I has been shown to be crucial for induction of ductal epithelial cells to differentiate into some cells. Lithostathine-1-alpha, also known as Pancreatic stone protein, Pancreatic thread protein, Regenerating islet-derived protein 1-alpha, REG1A, REG-1-alpha, and PSPS, is highly expressed in fetal and infant brains. REG1A contains one C-type lectin domain and is a known growth factor affecting pancreatic islet beta cells. REG1A may act as an inhibitor of spontaneous calcium carbonate precipitation. It may also be associated with neuronal sprouting in brain, and with brain and pancreas regeneration. REG1A has been reported to be expressed in human cancers, and it may be positively correlated with patient's prognosis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. High levels of REG1A expression by tumor cells are an independent predictor of a poor prognosis in patients with non-small cell lung cancer (NSCLC).

References
  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
  • Tezel E, et al. (2004) REG I as a marker for human pancreatic acinoductular cells. Hepatogastroenterology. 51(55): 91-6.
  • Geng J, et al. (2009) REG1A predicts recurrence in stage Ta/T1 bladder cancer. Eur J Surg Oncol. 35(8): 852-7.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"