Quick Order

Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SMYD3cDNA Clone Product Information
cDNA Size:1287
cDNA Description:ORF Clone of Homo sapiens SET and MYND domain containing 3 transcript variant 1 DNA.
Gene Synonym:KMT3E, ZMYND1, ZNFN3A1, FLJ21080, MGC104324, bA74P14.1, SMYD3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11230-ACG$325
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11230-ACR$325
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11230-ANG$325
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11230-ANR$325
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11230-CF$295
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11230-CH$295
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11230-CM$295
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11230-CY$295
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG11230-G$95
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11230-NF$295
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11230-NH$295
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11230-NM$295
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11230-NY$295
Human SMYD3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11230-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

SET and MYND domain-containing protein 3, also known as Zinc finger MYND domain-containing protein 1, SMYD3, and ZMYND, is a member of the histone-lysine methyltransferase family. SMYD3 contains one MYND-type zinc finger and one SET domain. SMYD3 is a histone H3 lysine-4-specific methyltransferase. It is expressed in skeletal muscles and testis. It is overexpressed in a majority of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC). SMYD3 plays an important role in transcriptional regulation in human carcinogenesis. It activates the transcription of a set of downstream genes. Of these downstream genes, there are several oncogenes and genes associated with cell adhesion (including those of N-Myc, CrkL, Wnt10b, L-selectin, CD31 and galectin-4), which have been shown to have effects on cell viability, adhesion, migration and metastasis. Increased SMYD3 expression is essential for the proliferation of breast cancer cells. SMYD3 may be a promising new target of therapeutic intervention for the treatment of cancers or other pathological processes associated with cell adhesion and migration.

  • Hamamoto, R. et al., 2006, Cancer Sci. 97 (2): 113-8.
  • Luo, XG. et al., 2007, J Biosci Bioeng. 103 (5): 444-50.
  • Wang, XQ. et al., 2007, Exp Oncol. 29 (1): 71-3.
  • Silva, FP. et al., 2008, Oncogene. 27 (19): 2686-92.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items