Quick Order

Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TRDMT1cDNA Clone Product Information
cDNA Size:1176
cDNA Description:ORF Clone of Homo sapiens tRNA aspartic acid methyltransferase 1 DNA.
Gene Synonym:DMNT2, DNMT2, PuMet, RNMT1, M.HsaIIP, TRDMT1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11224-ACG$325
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11224-ACR$325
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11224-ANG$325
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11224-ANR$325
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11224-CF$295
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11224-CH$295
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11224-CM$295
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11224-CY$295
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone)HG11224-M$195
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11224-NF$295
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11224-NH$295
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11224-NM$295
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11224-NY$295
Human DNMT2 / TRDMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11224-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

DNMT2, also known as tRNA (cytosine-5-)-methyltransferase, DNA methyltransferase homolog HsaIIP, and TRDMT1, is a member of the DNA methyltransferase family of enzymes. DNMT2 enzymes have been widely conserved during evolution and contain all of the signature motifs of DNA (cytosine-5)-methyltransferases. It contains all 10 sequence motifs that are conserved among m(5)C MTases, including the consensus S:-adenosyl-L-methionine-binding motifs and the active site ProCys dipeptide, and its structure is very similar to prokaryotic DNA methyltransferases. DNMT2 has close homologs in plants, insects and Schizosaccharomyces pombe, but no related sequence can be found in the genomes of Saccharomyces cerevisiae or Caenorhabditis elegans. While the biological function of DNMT2 is not yet known, the strong binding to DNA suggests that DNMT2 may mark specific sequences in the genome by binding to DNA through the specific target-recognizing motif. However, the DNA methyltransferase activity of these proteins is comparatively weak and their biochemical and functional properties remain enigmatic. Recent evidence now shows that Dnmt2 has a novel tRNA methyltransferase activity, raising the possibility that the biological roles of these proteins might be broader than previously thought.

  • Dong A, et al. (2001) Structure of human DNMT2, an enigmatic DNA methyltransferase homolog that displays denaturant-resistant binding to DNA. Nucleic Acids Res. 29(2): 439-48.
  • Hermann A, et al. (2003) The human Dnmt2 has residual DNA-(cytosine-C5) methyltransferase activity. J Biol Chem. 278(34): 31717-21.
  • Jeltsch A, et al. (2006) Two substrates are better than one: dual specificities for Dnmt2 methyltransferases. Trends Biochem Sci. 31(6): 306-8.
  • Schaefer M, et al. (2010) Solving the Dnmt2 enigma. Chromosoma. 119(1): 35-40.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items