Quick Order

Human CSF3R / CD114 / G-CSFR transcript variant 1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSF3R cDNA Clone Product Information
Gene_bank_ref_id:NM_000760.2
RefSeq ORF Size:2511bp
cDNA Description:Full length Clone DNA of Homo sapiens colony stimulating factor 3 receptor (granulocyte), transcript variant 1 with N terminal His tag.
Gene Synonym:CSF3R, CD114, GCSFR
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CSF3R / CD114 / G-CSFR transcript variant 1 ORF mammalian expression plasmid, N-His tag on other vectors
Product nameProduct name
Human M-CSF / CSF-1 ProteinCynomolgus / Rhesus M-CSF / CSF-1 Protein (Fc Tag)Cynomolgus / Rhesus M-CSF / CSF-1 Protein (His Tag)Human M-CSF / CSF-1 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse M-CSF / CSF-1 ProteinHuman M-CSF / CSF-1 Protein (His Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human / Cynomolgus M-CSF / CSF-1 Protein (His Tag)Human G-CSFR / CD114 Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Mouse M-CSF / CSF-1 Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinRat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 ProteinHuman M-CSF / CSF-1 Protein (Fc Tag)
Background

Granulocyte Colony Stimulating Factor Receptor (G-CSFR), also known as CD114, which belongs to the cytokine receptor superfamily, is a cell surface receptor for colony stimulating factor 3 (CSF3). It is a critical regulator of granulopoiesis. This type I membrane protein has a composite structure consisting of an immunoglobulin(Ig)-like domain, a cytokine receptor-homologous (CRH) domain and three fibronectin type III (FNIII) domains in the extracellular region. Mutations in the G-CSF receptor leading to carboxy-terminal truncation transduce hyperproliferative growth responses, and are implicated in the pathological progression of severe congenital neutropenia (SCN) to acute myelogenous leukemia (AML). Additionally, autocrine/paracrine stimulation of G-CSFR may be important in the biology of solid tumors, including metastasis.

References
  • Kasper B, et al. (1999) Association of src-kinase Lyn and non-src-kinase Syk with the granulocyte colony-stimulating factor receptor (G-CSFR) is not abrogated in neutrophils from severe congenital neutropenia patients with point mutations in the G-CSFR mRNA. Int J Hematol. 70(4): 241-7.
  • Hollenstein U, et al. (2000) Endotoxin down-modulates granulocyte colony-stimulating factor receptor (CD114) on human neutrophils. J Infect Dis. 182(1): 343-6.
  • Kindwall-Keller TL, et al. (2008) Role of the proteasome in modulating native G-CSFR expression. Cytokine. 43(2): 114-23.
  • Beel K, et al. (2009) G-CSF receptor (CSF3R) mutations in X-linked neutropenia evolving to acute myeloid leukemia or myelodysplasia. Haematologica. 94(10): 1449-52.
  •  

    G-CSFR/CD114 related areas, pathways, and other information

    Size / Price
    Catalog: HG10218-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"