Quick Order

Text Size:AAA

Human RUVBL1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RUVBL1 cDNA Clone Product Information
Gene_bank_ref_id:BC004531
RefSeq ORF Size:1371bp
cDNA Description:Full length Clone DNA of Homo sapiens RuvB-like 1 (E. coli) with N terminal Flag tag.
Gene Synonym:RVB1, TIH1, ECP54, TIP49, INO80H, NMP238, PONTIN, TIP49A, Pontin52
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-RUVBL1
Restriction Site:KpnI + XbaI (6kb + 1.42kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RUVBL1 Gene Plasmid Map
Human RUVBL1 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

RUVBL1, also known as RVB1, is a component of the NuA4 histone acetyltransferase complex and belongs to the RuvB family. RUVBL1 is ubiquitously expressed with high expression in heart, skeletal muscle and testis. It possesses single-stranded DNA-stimulated ATPase and ATP-dependent DNA helicase (3' to 5') activity. RUVBL1 is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. RUVBL1 plays an essential role in oncogenic transformation by MYC and also modulates transcriptional activation by the LEF1/TCF1-CTNNB1 complex. It also is essential for cell proliferation. RUVBL1 may be able to bind plasminogen at cell surface and enhance plasminogen activation.

References
  • Bauer A, et al. (1998) Pontin52, an interaction partner of beta-catenin, binds to the TATA box binding protein. Proc Natl Acad Sci. 95(25):14787-92.
  • Ewing, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Puri T, et al. (2007) Dodecameric structure and ATPase activity of the human TIP48/TIP49 complex. J Mol Biol. 366(1):179-92.
  • Size / Price
    Catalog: HG14074-NF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"