Quick Order

Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LXNcDNA Clone Product Information
cDNA Size:669
cDNA Description:ORF Clone of Homo sapiens latexin DNA.
Gene Synonym:LXN, ECI, TCI
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10211-ACG$325
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10211-ACR$325
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10211-ANG$325
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10211-ANR$325
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10211-CF$295
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10211-CH$295
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10211-CM$295
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10211-CY$295
Human Latexin Gene cDNA Clone (full-length ORF Clone)HG10211-M$95
Human Latexin Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10211-M-F$295
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10211-NF$295
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10211-NH$295
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10211-NM$295
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10211-NY$295
Human Latexin Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10211-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mouse Latexin, also known as endogenous carboxypeptidase inhibitor, tissue carboxypeptidase inhibitor, TCI, ECI and LXN, is a cytoplasm protein which belongs to the protease inhibitor I47 (latexin) family. It is highly expressed in heart, prostate, ovary, kidney, pancreas, and colon. Latexin / LXN is the only known endogenous specific inhibitor of zinc-dependent metallocarboxypeptidases (MCPs) present in mammalians so far. Latexin is originally identified as a molecular marker for the regional specification of the neocortex in development in rats. The 222 amino acid latexin in human shows different expression distribution with high levels in heart, prostate, ovary, kidney, pancreas, and colon, but only moderate or low levels in other tissues including brain. Latexin is also expressed at high levels and is inducible in macrophages in concert with other protease inhibitors and potential protease targets, and thus is suggested to play a role in inflammation and innate immunity pathways. Despite of the non-detectable sequence similarity with plant and parasite inhibitors, Latexin is related to a human putative tumor suppressor protein, TIG1. In addition, Latexin is also implicated in Alzheimer's disease.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items