After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CYB5R1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CYB5R1 cDNA Clone Product Information
Gene_bank_ref_id:BC018732
RefSeq ORF Size:918bp
cDNA Description:Full length Clone DNA of Homo sapiens cytochrome b5 reductase 1 with N terminal Myc tag.
Gene Synonym:B5R1, B5R.1, NQO3A2, humb5R2, CYB5R1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
References
  • Troncoso C, et al. (2008) Influence of electron transport proteins on the reactions catalyzed by Fusarium fujikuroi gibberellin monooxygenases. Phytochemistry. 69(3): 672-83.
  • Qian W, et al. (1998) The influence of mutation at Glu44 and Glu56 of cytochrome b5 on the protein's stabilization and interaction between cytochrome c and cytochrome b5. Biochemistry. 37 (40): 14137-50.
  • Zhu H, et al. (2000) Identification of a cytochrome b-type NAD(P)H oxidoreductase ubiquitously expressed in human cells. Proc Natl Acad Sci. 96 (26): 14742-7.
  • Size / Price
    Catalog: HG13227-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"