Quick Order

Text Size:AAA

Human E-Cadherin ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CDH1 cDNA Clone Product Information
Gene_bank_ref_id:NM_004360.3
RefSeq ORF Size:2649bp
cDNA Description:Full length Clone DNA of Homo sapiens cadherin 1, type 1, E-cadherin (epithelial) (CDH1) with N terminal His tag.
Gene Synonym:CDH1, UVO, CDHE, ECAD, LCAM, Arc-1, CD324
Species:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-CDH1
Restriction Site:HindIII + XbaI (6kb + 2.7kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2103T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in connecting cells, and thus may contribute to the sorting of heterogeneous cell type. E-cadherin (E-Cad), also known as CDH1 and CD324, is a calcium-dependent cell adhesion molecule the intact function of which is crucial for the establishment and maintenance of epithelial tissue polarity and structural integrity. Mutations in CDH1 occur in diffuse type gastric cancer, lobular breast cancer, and endometrial cancer. In human cancers, partial or complete loss of E-cadherin expression correlates with malignancy. During apoptosis or with calcium influx, E-Cad is cleaved by the metalloproteinase to produce fragments of about 38 kDa (E-CAD/CTF1), 33 kDa (E-CAD/CTF2) and 29 kDa (E-CAD/CTF3), respectively. E-Cad has been identified as a potent invasive suppressor, as downregulation of E-cadherin expression is involved in dysfunction of the cell-cell adhesion system, and often correlates with strong invasive potential and poor prognosis of human carcinomas.

References
  • Wang HD, et al. (2004) CDH1 germline mutation in hereditary gastric carcinoma. World J Gastroenterol. 10(21): 3088-93.
  • Masterson J, et al. (2007) Posttranslational truncation of E-cadherin and significance for tumour progression. Cells Tissues Organs. 185(1-3): 175-9.
  • Mrgineanu E, et al. (2008) Correlation between E-cadherin abnormal expressions in different types of cancer and the process of metastasis. Rev Med Chir Soc Med Nat Iasi. 112(2): 432-6.
  • Size / Price
    Catalog: HG10204-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"