Quick Order

Text Size:AAA

Human SERPINB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINB3cDNA Clone Product Information
Gene_bank_ref_id:NM_006919.2
cDNA Size:1173
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 3 DNA.
Gene Synonym:SCC, T4-A, SCCA1, SCCA-1, HsT1196, SCCA-PD, SERPINB3
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human SERPINB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

SERPINB3, also known as SCCA-1, belongs to the serpin family. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases. SERPINB3 is expressed in some hepatocellular carcinoma (at protein level). Its expression is closely related to cellular differentiation in both normal and malignant squamous cells. It seems to also be secreted in plasma by cancerous cells but at a low level. SERPINB3 significantly attenuates apoptosis by contrasting cytochrome c release from the mitochondria and by antichemotactic effect for NK cells. It may act as a protease inhibitor to modulate the host immune response against tumor cells and may be involved in the malignant behavior of squamous cell carcinoma cells.

References
  • Schneider SS, et al. (1995) A serine proteinase inhibitor locus at 18q21.3 contains a tandem duplication of the human squamous cell carcinoma antigen gene. Proc Natl Acad Sci. 92(8):3147-51.
  • Suminami Y, et al.. (1992) Squamous cell carcinoma antigen is a new member of the serine protease inhibitors. Biochem Biophys Res Commun. 181(1):51-8.
  • Mino-Miyagawa N, et al. (1990) Tumor-antigen 4. Its immunohistochemical distribution and tissue and serum concentrations in squamous cell carcinoma of the lung and esophagus. Cancer. 66(7):1505-12.
  • Size / Price
    Catalog:HG13218-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"