Quick Order

Text Size:AAA

Human FTH1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FTH1 cDNA Clone Product Information
Gene_bank_ref_id:NM_002032.2
RefSeq ORF Size:552bp
cDNA Description:Full length Clone DNA of Homo sapiens ferritin, heavy polypeptide 1 with N terminal Myc tag.
Gene Synonym:FHC, FTH, PLIF, FTHL6, PIG15, MGC104426, FTH1
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

FTH1 (ferritin, heavy polypeptide 1) is the heavy subunit of ferritin which is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. FTH1 gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. FTH1 stores iron in a soluble, non-toxic, readily available form. It is important for iron homeostasis. It has ferroxidase activity. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. It also plays a role in delivery of iron to cells. FTH1 mediates iron uptake in capsule cells of the developing kidney.

References
  • Hentze MW, et al. (1986) Cloning, characterization, expression, and chromosomal localization of a human ferritin heavy-chain gene. Proc Natl Acad Sci. 83(19):7226-30.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Stelzl, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-968.
  • Size / Price
    Catalog: HG13217-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"