After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSRP1cDNA Clone Product Information
Gene_bank_ref_id:NM_004078.2
cDNA Size:582
cDNA Description:ORF Clone of Homo sapiens cysteine and glycine-rich protein 1 DNA.
Gene Synonym:CRP, CRP1, CSRP, CYRP, D1S181E, DKFZp686M148, CSRP1
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11201-ACG$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11201-ACR$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11201-ANG$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11201-ANR$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11201-CF$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11201-CH$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11201-CM$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11201-CY$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone)HG11201-M$95
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11201-M-F$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11201-M-N$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11201-NF$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11201-NH$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11201-NM$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11201-NY$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11201-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Mouse Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains two LIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.

References
  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"