After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ABL1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ABL1 cDNA Clone Product Information
Gene_bank_ref_id:BC_117451.1
RefSeq ORF Size:3450bp
cDNA Description:Full length Clone DNA of Homo sapiens c-abl oncogene 1, receptor tyrosine kinase with C terminal His tag.
Gene Synonym:ABL, JTK7, p150, c-ABL, v-abl, bcr/abl,
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

c-Abl belongs to the class of tyrosine kinases and is the prototype of a subfamily which includes two members, c-Abl and Arg (Abl-related gene). Both proteins are localized at the cell membrane, actin cytoskeleton and cytosol, and c-Abl is present in the nucleus as well. c-Abl is a non-receptor tyrosine kinase that participates in multiple signaling pathways linking the cell surface, cytoskeleton, and the nucleus. Recent in vitro studies have also linked c-Abl to amyloid-beta-induced toxicity and tau phosphorylation. c-Abl has been implicated in many cellular processes including differentiation, division, adhesion, death, and stress response. c-Abl is a latent tyrosine kinase that becomes activated in response to numerous extra- and intra-cellular stimuli. The c-Abl protein is a ubiquitously expressed nonreceptor tyrosine kinase involved in the development and function of many mammalian organ systems, including the immune system and bone. It regulates the cellular response to TAM through functional interaction with the estrogen receptor, which suggests c-Abl as a therapeutic target and a prognostic tumor marker for breast cancer. c-Abl also plays a key role in signaling chemokine-induced T-cell migration. In addition, c-Abl contains NLSs (nuclear localization signals) and DNA-binding sequences important for nuclear functions. c-Abl has become an important therapeutic target in human chronic myeloid leukaemia.

References
  • Qiu Z, et al. (2010) c-Abl tyrosine kinase regulates cardiac growth and development. Proc Natl Acad Sci U S A. 107(3): 1136-41.
  • Huang Y, et al. (2008) The c-Abl tyrosine kinase regulates actin remodeling at the immune synapse. Blood. 112(1): 111-9.
  • Sirvent A, et al. (2008) Cytoplasmic signalling by the c-Abl tyrosine kinase in normal and cancer cells. Biol Cell. 100(11): 617-31.
  • Shaul Y, et al. (2005) Role of c-Abl in the DNA damage stress response. Cell Res. 15(1): 33-5.
  • Size / Price
    Catalog: HG11199-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"