After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PROK1cDNA Clone Product Information
cDNA Size:318
cDNA Description:ORF Clone of Homo sapiens prokineticin 1 DNA.
Gene Synonym:PROK1, PK1, PRK1, EGVEGF
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10183-ACG$325
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10183-ACR$325
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10183-CF$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10183-CH$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10183-CM$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10183-CY$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone)HG10183-M$95
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10183-M-F$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10183-M-N$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10183-NF$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10183-NH$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10183-NM$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10183-NY$295
Human PROK1 / EG-VEGF Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10183-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

EG-VEGF, also known as prokineticin-1, is a member of the AVIT (prokineticin) family. Prokineticins are secreted proteins that can promote angiogenesis and induce strong gastrointestinal smooth muscle contraction. EG-VEGF can be detected in the steroidogenic glands, ovary, testis, adrenal and placenta. EG-VEGF has little or no effect on a variety of other endothelial and non-endothelial cell types. It induces proliferation, migration and fenestration (the formation of membrane discontinuities) in capillary endothelial cells derived from endocrine glands. It directly influences neuroblastoma progression by promoting the proliferation and migration of neuroblastoma cells. EG-VEGF may play a role in placentation. It may also function in normal and pathological testis angiogenesis. It positively regulates PTGS2 expression and prostaglandin synthesis.

  • Masuda Y, et al. (2002) Isolation and identification of EG-VEGF/prokineticins as cognate ligands for two orphan G-protein-coupled receptors. Biochem. Biophys. Res. Commun. 293 (1): 396-402.
  • Pasquali D. et al. (2006) The endocrine-gland-derived vascular endothelial growth factor (EG-VEGF)/prokineticin 1 and 2 and receptor expression in human prostate: Up-regulation of EG-VEGF/prokineticin 1 with malignancy. Endocrinology. 147 (9): 4245-51.
  • Ngan ES, et al. (2008) Prokineticin-1 (Prok-1) works coordinately with glial cell line-derived neurotrophic factor (GDNF) to mediate proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1783 (3): 467-78.
  • Ngan ES, et al. (2007) Prokineticin-1 modulates proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1773 (4): 536-45.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items