Quick Order

Human RSPO3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSPO3cDNA Clone Product Information
Gene_bank_ref_id:NM_032784.3
cDNA Size:819
cDNA Description:ORF Clone of Homo sapiens R-spondin 3 homolog (Xenopus laevis) DNA.
Gene Synonym:PWTSR, THSD2, CRISTIN1, FLJ14440, RSPO3
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Background

R-spondin 3 (RSPO3) is a member of the R-Spondin (RSPO) family in vertebrates that activate Wnt/beta-catenin signaling, plays a key role in these processes. The RSPO family of secreted Wnt modulators is involved in development and disease and holds therapeutic promise as stem cell growth factors. The four members have high structural homology. RSPO2 and RSPO3 are more potent than RSPO1, whereas RSPO4 is relatively inactive. All RSPO members require Wnt ligands and LRP6 for activity and amplify signaling of Wnt3A, Wnt1, and Wnt7A, suggesting that RSPO proteins are general regulators of canonical Wnt signaling. RSPO3/PCP signaling during gastrulation requires Wnt5a and is transduced via Fz7, Dvl, and JNK. RSPO3 functions by inducing Sdc4-dependent, clathrin-mediated endocytosis. RSPO3 is a novel, evolutionarily conserved angiogenic factor in embryogenesis. RSPO3 has a key role in the interaction between chorion and allantois in labyrinthine development.

References
  • Aoki M, et al. (2007) R-spondin3 is required for mouse placental development. Dev Biol. 301(1): 218-26.
  • Kazanskaya O, et al. (2008) The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development. Development. 135(22): 3655-64.
  • Kim KA, et al. (2008) R-Spondin family members regulate the Wnt pathway by a common mechanism. Mol Biol Cell. 19(6): 2588-96.
  • Ohkawara B, et al. (2011) Rspo3 Binds Syndecan 4 and Induces Wnt/PCP Signaling via Clathrin-Mediated Endocytosis to Promote Morphogenesis. Dev Cell. 20(3): 303-14.
  • Size / Price
    Catalog:HG11185-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"