Quick Order

Human NGFR Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NGFRcDNA Clone Product Information
cDNA Size:1284
cDNA Description:ORF Clone of Homo sapiens nerve growth factor receptor (TNFR superfamily, member 16) DNA.
Gene Synonym:CD271, p75NTR, TNFRSF16, p75(NTR), Gp80-LNGFR, NGFR
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Neurotrophin & Receptor Related Products

Nerve growth factor receptors (NGFRs) belong to a large growth factor receptor family. NGFR includes two types of receptors: high-affinity nerve growth factor receptor and low-affinity nerve growth factor receptor. High-affinity nerve growth factor receptor is also referred as Trk familywhose members are bound by some neurotrophins with high affinity. Nerve growth factor binds with TrkA after being released from target cells, the NGF / TrkA complex is subsequently trafficked back to the cell body. The Low-affinity nerve growth factor receptor also named p75 which binds with all kinds of neurotrophins with low affinity. All the four kinds of neurotrophins, including Nerve growth factor, Brain derived neurotrophic factor, Neurotrophin-3, and Neurotrophin-4 bind to the p75. Studies have proved that NGFR acts as a molecular signal swith that determines cell death or survival by three steps. First, pro-nerve growth factor (prNGF) triggers cell apoptosis by its high affinity binding to p75NTR, while NGF induces neuronal survival with low-affinity binding. Second, p75NTR mediates cell death by combining with co-receptor sortilin, whereas it promotes neuronal survival through combination with proNGF. Third, release of the intracellular domain chopper or cleavage short p75 NTR can independently initiate neuronal apoptosis.

  • Chen LW, et al. (2008) The proNGF-p75NTR-sortilin signalling complex as new target for the therapeutic treatment of Parkinson's disease. CNS Neurol Disord Drug Targets. 7(6): 512-23.
  • Deponti D, et al. (2009) The low-affinity receptor for neurotrophins p75NTR plays a key role for satellite cell function in muscle repair acting via RhoA. Mol Biol Cell.20(16): 3620-7.
  • Ken-ichiro K, et al. (2004) Necdin-related MAGE proteins differentially interact with the E2F1 transcription factor and the p75 neurotrophin receptor. J Biol Chem. 279 (3): 1703-12.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items