After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human VSTM1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VSTM1 cDNA Clone Product Information
NCBI RefSeq:NM_198481.3
RefSeq ORF Size:711bp
cDNA Description:Full length Clone DNA of Homo sapiens V-set and transmembrane domain containing 1 with N terminal Myc tag.
Gene Synonym:SIRL1, UNQ3033, MGC119160, MGC119161, VSTM1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

V-set and transmembrane domain containing 1 (VSTM1) is a protein containing the V-set domains. V-set domains are immunoglobulin-like domains resembling the antibody variable region. V-set domains are found in many kinds of protein families, including immunoglobulin light and heavy chains, several T-cells such as CD2, CD4, CD80, and CD86, myelin membrane adhesion molecules, junction adhesion molecules (JAM), tyrosine-protein kinase receptors, and the programmed cell death protein1.

References
  • Satow Y, et al. (1986) Phosphocholine binding immunoglobulin Fab McPC603. An X-ray diffraction study at 2.7 A. J Mol Biol. 190 (4): 593-604.
  • Rees DC, et al. (2009) ABC transporters: the power to change. Cell Biol. 10 (3): 218-227.
  • Size / Price
    Catalog: HG13171-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"