Quick Order

Text Size:AAA

Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PFKMcDNA Clone Product Information
Gene_bank_ref_id:XM_005570698.1
cDNA Size:2343
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) phosphofructokinase, muscle DNA.
Gene Synonym:PFKM
Species:Cynomolgus
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90449-ACG$345
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90449-ACR$345
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90449-ANG$345
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90449-ANR$345
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90449-CF$315
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90449-CH$315
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90449-CM$315
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90449-CY$315
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone)CG90449-G$195
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90449-NF$315
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90449-NH$315
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90449-NM$315
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90449-NY$315
Cynomolgus monkey PFKM Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90449-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"