After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RPS6KA6cDNA Clone Product Information
Gene_bank_ref_id:NM_014496.2
cDNA Size:2238
cDNA Description:ORF Clone of Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 6 (RPS6KA6) DNA.
Gene Synonym:RPS6KA6, RSK4
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10147-ACG$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10147-ACR$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10147-ANG$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10147-ANR$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10147-CF$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10147-CH$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10147-CM$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10147-CY$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone)HG10147-M$115
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10147-M-F$345
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10147-NF$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10147-NH$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10147-NM$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10147-NY$315
Human RPS6KA6 / RSK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10147-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Ribosomal protein S6 kinase alpha-6, also known as Ribosomal S6 kinase 4, 90 kDa ribosomal protein S6 kinase 6,RSK-4, RSK4 and RPS6KA6, is a protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA6 contains one AGC-kinase C-terminal domain and two protein kinase domains. RPS6KA6 forms a complex with either ERK1 or ERK2 in quiescent cells. RPS6KA6 shows a high level of homology to three isolated members of the human RSK family. RSK2 is involved in Coffin-Lowry syndrome and nonspecific MRX. The localization of RPS6KA6 in the interval that is commonly deleted in mentally retarded males together with the high degree of amino acid identity with RSK2 suggests that RPS6KA6 plays a role in normal neuronal development. Further mutation analyses in males with X-linked mental retardation must prove that the gene of RPS6KA6 is indeed a novel MRX gene. RPS6KA6 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA6 is activated by multiple phosphorylations on threonine and serine residues.

Size / Price
Catalog:HG10147-NH
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"