After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human IL12Rb2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL12RB2cDNA Clone Product Information
Gene_bank_ref_id:NM_001559.2
cDNA Size:2589
cDNA Description:ORF Clone of Homo sapiens interleukin 12 receptor, beta 2 DNA.
Gene Synonym:IL12RB2, RP11-102M16.1
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human IL12Rb2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
IL-12 Family & Receptor Related Products
Product nameProduct name
Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12B / P40 Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL27 / Interleukin-27 Protein (His Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12RB1 / IL12RB / CD212 Protein (His Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL12B / IL-12B Protein (Fc Tag)Mouse IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinCynomolgus / Rhesus IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL27 / Interleukin-27 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Cynomolgus / Rhesus IL12A / NKSF1 Protein (Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag) Cynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Marmoset IL12B / IL-12B Protein (Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL12A & IL27B Heterodimer Protein
Background

Interleukin-12 receptor subunit beta-2 (IL12RB2), also known as IL-12 receptor subunit beta-2, IL-12R subunit beta-2, IL-12R-beta-2, and IL-12RB2, is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. IL12RB2 belongs to the type I cytokine receptor family. The coexpression of IL12RB2 and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of IL12RB2 is up-regulated by IFN gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of IL12RB2 is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. This subunit is the signaling component coupling to the JAK2/STAT4 pathway. IL12RB2 promotes the proliferation of T-cells as well as NK cells. IL12RB2 induces the promotion of T-cells towards the Th1 phenotype by strongly enhancing IFN-gamma production.

References
  • Yamamoto K, et al. (1997) Assignment of IL12RB1 and IL12RB2, interleukin-12 receptor beta 1 and beta 2 chains, to human chromosome 19 band p13.1 and chromosome 1 band p31.2, respectively, by in situ hybridization. Cytogenet. 77 (3-4): 257-8.
  • Morton SM, et al. (1998) Assignment of IL12RB2 to human chromosome 1p31.3→p31.2 between D1S230 and D1S198. Cytogenet. Cell Genet. 79 (3-4): 282-3.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA. 99 (26): 16899-903.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"