Quick Order

Text Size:AAA

Human AK2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AK2 cDNA Clone Product Information
Gene_bank_ref_id:BC009405
RefSeq ORF Size:720bp
cDNA Description:Full length Clone DNA of Homo sapiens adenylate kinase 2 with N terminal Myc tag.
Gene Synonym:ADK2, AK2, AK2
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Adenylate kinase 2 (AK2) belongs to the Adenylate kinase family that contains three isozymes: AK1, AK2 and AK3. Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Adenylate kinase2 (AK2) is expressed in mitochondrial intermembrane space. It may play a role in apoptosis. It has been demonstrated that in apoptotic cells AK2 was translocated into the cytosol concomitantly with cytochronme C. Mutations in this gene are the cause of reticular dysgenesis. These mutations result in absent or strongly decreased protein expression. It has been also established that AK2 is specifically expressed in the stria vascularis region of the inner ear, which provides an explanation of the sensorineural deafness in these individuals. 

References
  • Lagresle-Peyrou C, et al. (2008) Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature Genetics. 41: 106-11.
  • Bruns GA, et al. (1977) Adenylate kinase 2, a mitochondrial enzyme. Biochem Genet. 15 (5-6): 477-86.
  • Khler C, et al. (1999) Release of adenylate kinase 2 from the mitochondrial intermembrane space during apoptosis. FEBS Lett. 447 (1): 10-2.
  • Size / Price
    Catalog: HG13146-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"