Quick Order

Text Size:AAA

Human SH2D1A ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SH2D1A cDNA Clone Product Information
Gene_bank_ref_id:NM_002351.3
RefSeq ORF Size:387bp
cDNA Description:Full length Clone DNA of Homo sapiens SH2 domain protein 1A with C terminal His tag.
Gene Synonym:LYP, SAP, XLP, DSHP, EBVS, IMD5, XLPD, MTCP1, FLJ18687, FLJ92177, SH2D1A
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

SH2 domain-containing protein 1A (SH2D1A / SAP) is a 128 amino acid protein, containing a single Src homology 2 (SH2) domain, flanked by 5 amino acids at the N-terminus and 25 amino acids at the C-terminus. The absence of a catalytic domain and the presence of an SH2 domain suggest that SH2D1A regulates one or more signal transduction pathways. SH2D1A interacts with signaling lymphocytic activation molecule (SLAM), which is a transmembrane protein expressed on the surface of activated T and B cells. SH2D1A (SAP) interacts via its SH2 domain with a motif (TIYXXV) present in the cytoplasmic tail of the cell-surface receptors, including CD150 / SLAM, CD84, CD229 / Ly-9, and CD244 / 2B4. SH2D1A was expressed in EBV-carrying, tumor phenotype representative (type I), but not in EBV-carrying lymphoblastoid cell line (LCL)-like (type III) or EBV-negative Burkitt lymphoma (BL) lines. It has been supposed to be related to the X-linked lymphoproliferative disease which is also known as Duncan's disease or Purtilo syndrome. 

References
  • Morra M, et al. (2005) Defective B cell responses in the absence of SH2D1A. PNAS. 102 (13): 4819-23.
  • Morra M, et al. (2001) Characterization of SH2D1A Missense Mutations Identified in X-linked Lymphoproliferative Disease Patients. The Journal of Biological Chemistry. 276: 36809-16.
  • Hron JD, et al. (2004) SH2D1A Regulates T-dependent Humoral Autoimmunity. JEM. 200 (2): 261-6.
  • Size / Price
    Catalog: HG11149-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"