Quick Order

Text Size:AAA

Human RTN4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RTN4cDNA Clone Product Information
Gene_bank_ref_id:BC001035
cDNA Size:600
cDNA Description:ORF Clone of Homo sapiens reticulon 4 DNA.
Gene Synonym:ASY, NSP, NOGO, NOGOC, RTN-X, NOGO-A, NSP-CL, Nogo-B, Nogo-C, RTN4-A, RTN4-C, RTN4-B1, RTN4-B2, NI220/250, Nbla00271, RTN4Nbla10545
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Reticulon-4, also known as Foocen, Neurite outgrowth inhibitor, Nogo protein, Neuroendocrine-specific protein, Neuroendocrine-specific protein C homolog, RTN-x, Reticulon-5 and RTN4, is a multi-pass membrane protein which contains one reticulon domain. Isoform 1 of RTN4 is specifically expressed in brain and testis and weakly in heart and skeletal muscle. Isoform 2 of RTN4 is widely expressed except for the liver. Isoform 3 of RTN4 is expressed in brain, skeletal muscle and adipocytes. Isoform 4 of RTN4 is testis-specific. Reticulon-4 / RTN4 is a developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Reticulon-4 / RTN4 regulates neurite fasciculation, branching and extension in the developing nervous system. Reticulon-4 / RTN4 is involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. It regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Isoform 2 of RTN4 reduces the anti-apoptotic activity of Bcl-xl and Bcl-2. This is likely consecutive to their change in subcellular location, from the mitochondria to the endoplasmic reticulum, after binding and sequestration. Isoform 2 and isoform 3 of RTN4 inhibit BACE1 activity and amyloid precursor protein processing.

References
  • Yang J., et al., 2000, Cytogenet. Cell Genet. 88:101-102.
  • Prinjha R., et al., 2000, Nature 403: 383-384.
  • Tagami S., et al., 2000, Oncogene 19: 5736-5746.
  • Murayama K.S., et al., 2006, Eur. J. Neurosci. 24: 1237-1244.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Choudhary C., et al., 2009, Science 325: 834-840.
  • Size / Price
    Catalog:HG12261-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"