Quick Order

Human UBASH3A ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human UBASH3A cDNA Clone Product Information
Gene_bank_ref_id:BC069511
RefSeq ORF Size:1872bp
cDNA Description:Full length Clone DNA of Homo sapiens ubiquitin associated and SH3 domain containing, A with N terminal Flag tag.
Gene Synonym:CLIP4, STS-2, TULA, TULA-1, UBASH3A
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

UBASH3A is a member of the T-cell ubiquitin ligand (TULA) family. This family consists of two members. Both of them can negatively regulate T-cell signaling. UBASH3A can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of UBASH3A gene results in multiple transcript variants. It interferes with CBL-mediated down-regulation and degradation of receptor-type tyrosine kinases. UBASH3A promotes accumulation of activated target receptors, such as T-cell receptors, EGFR and PDGFRB, on the cell surface. UBASH3A also exhibits negligigle protein tyrosine phosphatase activity at neutral pH. It may act as a dominant-negative regulator of UBASH3B-dependent dephosphorylation. It may also inhibit dynamin-dependent endocytic pathways by functionally sequestering dynamin via its SH3 domain.

References
  • Collingwood TS, et al. (2007) T-cell ubiquitin ligand affects cell death through a functional interaction with apoptosis-inducing factor, a key factor of caspase-independent apoptosis.". J. Biol. Chem. 282 (42): 30920-8.
  • Smirnova EV, et al. (2008) TULA proteins bind to ABCE-1, a host factor of HIV-1 assembly, and inhibit HIV-1 biogenesis in a UBA-dependent fashion. Virology. 372(1):10-23.
  • Wattenhofer M, et al. (2001) Isolation and characterization of the UBASH3A gene on 21q22.3 encoding a potential nuclear protein with a novel combination of domains. Hum Genet. 108(2):140-7.
  • Size / Price
    Catalog: HG13847-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"