Quick Order

Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACP1cDNA Clone Product Information
cDNA Size:477
cDNA Description:ORF Clone of Homo sapiens acid phosphatase 1, soluble , transcript variant 3 DNA.
Gene Synonym:HAAP, MGC3499, MGC111030
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10957-ACG$325
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10957-ACR$325
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10957-ANG$325
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10957-ANR$325
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10957-CF$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10957-CH$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10957-CM$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10957-CY$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone)HG10957-M$95
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10957-M-F$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10957-M-N$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10957-NF$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10957-NH$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10957-NM$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10957-NY$295
Human ACP1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10957-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

The low molecular weight phosphotyrosine phosphatase (LMW-PTP), also known as Acid phosphatase 1 (ACP1), belongs to the low molecular weight phosphotyrosine protein phosphatase family are involved in the regulation of important physiological functions, including stress resistance and synthesis of the polysaccharide capsule. ACP1/LMW-PTP is an enzyme involved in platelet-derived growth factor-induced mitogenesis and cytoskeleton rearrangement. LMW-PTP is able to specifically bind and dephosphorylate activated PDGF receptor, thus modulating PDGF-induced mitogenesis. In vitro, LMW-PTP was found to efficiently dephosphorylate activated FcgammaRIIA and LAT, but not Syk or phospholipase Cgamma2. The overexpression of LMW-PTP inhibited activation of Syk downstream of FcgammaRIIA and reduced intracellular Ca(2+) mobilization. It been demonstrated that LMW-PTP is responsible for FcgammaRIIA dephosphorylation, and is implicated in the down-regulation of cell activation mediated by this ITAM-bearing immunoreceptor. In addition, ACP1 is a highly polymorphic phosphatase that is especially abundant in the central nervous system and is known to be involved in several signal transduction pathways.

  • Cirri P, et al. (1998) Low molecular weight protein-tyrosine phosphatase tyrosine phosphorylation by c-Src during platelet-derived growth factor-induced mitogenesis correlates with its subcellular targeting. J Biol Chem. 273(49): 32522-7.
  • Chiarugi P, et al. (2002) Insight into the role of low molecular weight phosphotyrosine phosphatase (LMW-PTP) on platelet-derived growth factor receptor (PDGF-r) signaling. LMW-PTP controls PDGF-r kinase activity through TYR-857 dephosphorylation. J Biol Chem. 277(40): 37331-8.
  • Bottini N, et al. (2002) Convulsive disorder and the genetics of signal transduction; a study of a low molecular weight protein tyrosine phosphatase in a pediatric sample. Neurosci Lett. 333(3): 159-62.
  • Musumeci L, et al. (2005) Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. J Bacteriol. 187(14): 4945-56.
  • Mancini F, et al. (2007) The low-molecular-weight phosphotyrosine phosphatase is a negative regulator of FcgammaRIIA-mediated cell activation. Blood. 110(6): 1871-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items