Quick Order

Human PRTFDC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRTFDC1cDNA Clone Product Information
Gene_bank_ref_id:BC008662
cDNA Size:678
cDNA Description:ORF Clone of Homo sapiens phosphoribosyl transferase domain containing 1 DNA.
Gene Synonym:HHGP, PRTFDC1
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human PRTFDC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

PRTFDC1 is a member of the purine/pyrimidine phosphoribosyltransferase family. It can bind GMP, IMP and alpha-D-5-phosphoribosyl 1-pyrophosphate (PRPP). The epigenetic silencing of PRTFDC1 by hypermethylation of the CpG island leads to a loss of PRTFDC1 function, which might be involved in squamous cell oral carcinogenesis. PRTFDC1 is a genetic modifier of HPRT-deficiency in the mouse and has important implications for unraveling the molecular etiology of lesch-Nyhan disease(LND). LND is a severe X-linked neurological disorder caused by a deficiency of hypoxanthine phosphoribosyltransferase. PRTFDC1 has a low, barely measurable phosphoribosyltransferase activity (in vitro).

References
  • Welin M. et al., 2010, FEBS J. 277 (23): 4920-30.
  • Keebaugh AC. et al., 2011, PLoS One. 6 (7): e22381.
  • Suzuki E. et al., 2007, Oncogene. 26 (57): 7921-32.
  • Size / Price
    Catalog:HG14023-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"