After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SIGLEC6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SIGLEC6cDNA Clone Product Information
Gene_bank_ref_id:BC035359
cDNA Size:1281
cDNA Description:ORF Clone of Homo sapiens sialic acid binding Ig-like lectin 6 DNA.
Gene Synonym:CD327, CD33L, OBBP1, CD33L1, CD33L2, CDW327, SIGLEC6
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

SIGLEC6, also known as CD327, belongs to the immunoglobulin superfamily, SIGLEC (sialic acid binding Ig-like lectin) family. SIGLEC6 is a sialic acid recognizing protein expressed at high levels in placenta (cyto- and syncytiotrophoblastic cells) and at lower levels in spleen, peripheral blood leukocytes (predominantly B-cells) and small intestine. SIGLEC6 localizes in various compartments such as membrane fraction, extracellular region and so on. SIGLEC6 may show increasing expression human labor and following childbirth, it has been speculated that this expression helps to slow the tempo of human labor.  Interestingly, expression of SIGLEC6 is further upregulated in pre-eclampsia, which appears to be a uniquely human disease.

References
  • Winn VD. et al., 2009, Endocrinology. 150 (1): 452-62.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Lam KK. et al., 2011, J Biol Chem. 286 (43): 37118-27.
  • Size / Price
    Catalog:HG12241-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"