After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AARS Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AARScDNA Clone Product Information
Gene_bank_ref_id:NM_001605.2
cDNA Size:2907
cDNA Description:ORF Clone of Homo sapiens alanyl-tRNA synthetase DNA.
Gene Synonym:AARS
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human AARS Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name
Background

Alanyl-tRNA synthetase (AARS) belongs to the family of ligases, specifically those forming carbon-oxygen bonds in aminoacyl-tRNA and related compounds. This enzyme participates in alanine and aspartate metabolism and aminoacyl-tRNA biosynthesis. Alanyl-tRNA synthetase (AlaRS) catalyzes synthesis of Ala-tRNA (Ala) and hydrolysis of mis-acylated Ser- and Gly-tRNA (Ala) at 2 different catalytic sites. Their role is not confined to catalyze the attachment of amino acids to transfer RNAs and thereby establish the rules of genetic code by virtue of matching the nucleotide triplet of anticodon with cognate amino acid. Under apoptotic conditions in cell culture, the full-length enzyme is secreted, and the two cytokine activities can be generated by leukocyte elastase, an extracellular protease. Secretion of this tRNA synthetase may contribute to apoptosis both by arresting translation and producing needed cytokines. This protein could be an attractive target of drugs against bacterial, fungal and parasitic infections. 

References
  • Wakasugi K, et al. (1999) Two Distinct Cytokines Released from a Human Aminoacyl-tRNA Synthetase. Science. 284 (5411): 147-51.
  • Sokabe M, et al. (2009) The structure of alanyl-tRNA synthetase with editing domain. Proc Natl Acad Sci . 106 (27): 11028-33.
  • Skupinska M, et al. (2009) AARS--the etiological factor and the attractive target of many disorders. Postepy Biochem. 55 (4): 373-84.
  • Size / Price
    Catalog:HG10951-CH
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"