After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Ferret YWHAQ ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Ferret YWHAQ cDNA Clone Product Information
NCBI RefSeq:XM_004790119.1
RefSeq ORF Size:738bp
cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide with N terminal His tag.
Gene Synonym:YWHAQ
Species:Ferret
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Cheng Y, et al. (2010) Effect of 14-3-3 tau protein on differentiation in BeWo choriocarcinoma cells. Placenta. 31(1): 60-6.
  • Umahara T, et al. (2010) 14-3-3 proteins and spinocerebellar ataxia type 1: from molecular interaction to human neuropathology. Cerebellum. 9(2): 183-9.
  • Wang B, et al. (2004) A role for 14-3-3 tau in E2F1 stabilization and DNA damage-induced apoptosis. J Biol Chem. 279(52): 54140-52.
  • Size / Price
    Catalog: FG60106-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"