Quick Order

Text Size:AAA

Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FEScDNA Clone Product Information
cDNA Size:2469
cDNA Description:ORF Clone of Homo sapiens feline sarcoma oncogene DNA.
Gene Synonym:FPS, FES
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG12214-ACG$345
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG12214-ACR$345
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG12214-ANG$345
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG12214-ANR$345
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG12214-CF$315
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG12214-CH$315
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG12214-CM$315
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG12214-CY$315
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone)HG12214-G$195
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG12214-NF$315
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG12214-NH$315
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG12214-NM$315
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG12214-NY$315
Human FES Kinase / Feline sarcoma oncogene Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12214-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Proto-oncogene tyrosine-protein kinase Fes/Fps, also known as Proto-oncogene c-Fes, Proto-oncogene c-Fps, Feline sarcoma oncogene, FES and FPS, is a protein which contains one FCH domain, one protein kinase domain and one SH2 domain. FES is a non-receptor protein tyrosine kinase expressed in hematopoietic progenitors and differentiated myeloid cells. FES is observed in the nuclear, granular and plasma membrane fractions of primary human neutrophils and the myeloid leukemia cell line, HL-60. The nuclear localization is confirmed by immunocytochemistry of neutrophils. FES has been implicated in granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-3 (IL-3) and erythropoietin signal transduction. FES has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. FES is also involved in normal hematopoiesis. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia.

  • Bowden DW, et al.,1991, Nucleic acids Res 19 (15): 4311.
  • Yates,K.E. et al., 1995, Oncogene. 10 (6):1239-42.
  • Jücker, M, et al.,1997, J. Biol. Chem.  272 (4): 2104-9.
  • Smithgall,T.E. et al., 1998, Crit Rev Oncog. 9 (1):43-62.
  • Lionberger, et al.,2000, Cancer Res. 60 (4): 1097-103.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items